Stem-loop sequence cel-mir-58c

AccessionMI0039738 (change log)
DescriptionCaenorhabditis elegans miR-58c stem-loop
Literature search

19 open access papers mention cel-mir-58c
(215 sentences)

Stem-loop
   a      --a   c         g        c  -   a 
5'  uauuca   uug aaccuguug uugaucuc ua cca a
    ||||||   ||| ||||||||| |||||||| || ||| u
3'  auaagu   aac uuggauaac gacuagag au ggu a
   a      gaa   -         g        a  a   a 
Get sequence
Deep sequencing
264 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 6660634-6660712 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-58c
cel-mir-58cchrIV: 6660634-6660712 [-]
cel-mir-58bchrIV: 6660461-6660519 [-]
Database links

Mature sequence cel-miR-58c

Accession MIMAT0049030
Sequence

48 - 

agagaucaggcaauagguucaaa

 - 70

Get sequence
Deep sequencing262 reads, 16 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28645154 "ALG-5 is a miRNA-associated Argonaute required for proper developmental timing in the Caenorhabditis elegans germline" Brown KC, Svendsen JM, Tucci RM, Montgomery BE, Montgomery TA Nucleic Acids Res. 45:9093-9107(2017).