Stem-loop sequence cel-mir-55b

AccessionMI0039737 (change log)
DescriptionCaenorhabditis elegans miR-55b stem-loop
Stem-loop
   a     ---aa       a            a   g    gcauau 
5'  ggaau     ggggcuc gcagaaacuuau cgg uaua      c
    |||||     ||||||| |||||||||||| ||| ||||       
3'  ccuug     cccugag cgucuuuggaua gcc auau      c
   a     aauua       c            -   a    gaaaaa 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 13144830-13144919 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-55b
cel-mir-56chrX: 13144691-13144787 [-]
cel-mir-55chrX: 13144827-13144924 [-]
cel-mir-55bchrX: 13144830-13144919 [+]
cel-mir-54chrX: 13144996-13145094 [-]
Database links

Mature sequence cel-miR-55b

Accession MIMAT0049029
Sequence

54 - 

uaaccgauagguuucugccgag

 - 75

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28645154 "ALG-5 is a miRNA-associated Argonaute required for proper developmental timing in the Caenorhabditis elegans germline" Brown KC, Svendsen JM, Tucci RM, Montgomery BE, Montgomery TA Nucleic Acids Res. 45:9093-9107(2017).