Stem-loop sequence cel-mir-12134

AccessionMI0039736 (change log)
DescriptionCaenorhabditis elegans miR-12134 stem-loop
Stem-loop
   u    u                a      u         a 
5'  uuuu caagaaaguggucaac gaaaag uguagauaa g
    |||| |||||||||||||||| |||||| ||||||||| u
3'  agag guuuuuucacuaguug uuuuuc acaucuauu g
   u    u                a      u         a 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 18317750-18317832 [-]
intergenic
Database links

Mature sequence cel-miR-12134

Accession MIMAT0049028
Sequence

50 - 

uacaucuuuuuaguugaucacu

 - 71

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28645154 "ALG-5 is a miRNA-associated Argonaute required for proper developmental timing in the Caenorhabditis elegans germline" Brown KC, Svendsen JM, Tucci RM, Montgomery BE, Montgomery TA Nucleic Acids Res. 45:9093-9107(2017).