Stem-loop sequence hsa-mir-12121

AccessionMI0039723 (change log)
DescriptionHomo sapiens miR-12121 stem-loop
Stem-loop
   u g     g   g g     ---a       ---     -  -     -   c 
5'  g gcucg ccc g cugcc    cgagcgu   gcggg cc ucgcc ggg a
    | ||||| ||| | |||||    |||||||   ||||| || ||||| ||| u
3'  c cgggc ggg c ggcgg    gcucgcg   cgccc gg ggcgg ucc g
   g g     -   - g     gccg       acc     c  c     a   u 
Get sequence
Deep sequencing
643 reads, 35.6 reads per million, 87 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 104865314-104865411 [+]
intergenic
Database links

Mature sequence hsa-miR-12121

Accession MIMAT0049015
Sequence

16 - 

cugccacgagcgugcgggccu

 - 36

Get sequence
Deep sequencing15 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28471449 "Loss of miR-514a-3p regulation of PEG3 activates the NF-kappa B pathway in human testicular germ cell tumors" Ozata DM, Li X, Lee L, Liu J, Warsito D, Hajeri P, Hultman I, Fotouhi O, Marklund S, Ahrlund-Richter L, Juhlin CC, Larsson C, Lui WO Cell Death Dis. 8:e2759(2017).