Stem-loop sequence csi-MIR535e

AccessionMI0039709 (change log)
DescriptionCitrus sinensis miR535e stem-loop
Literature search

2 open access papers mention csi-MIR535e
(5 sentences)

Stem-loop
   caacu    u        ag       acacccgucagcauucgugca 
5'      uugu ugacaaug  agagagc                     a
        |||| ||||||||  |||||||                     a
3'      agca acuguuac  ucucucg                     u
   -----    u        ca       uucgaucaucugucggaacgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 14823918-14824011 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR535e
csi-MIR535echr2: 14823918-14824011 [-]
csi-MIR535achr2: 14822032-14822172 [-]
Database links

Mature sequence csi-miR535e-5p

Accession MIMAT0049000
Sequence

11 - 

ugacaaugagagagagcacac

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).