Stem-loop sequence gga-mir-9-4

AccessionMI0039523 (change log)
DescriptionGallus gallus miR-9-4 stem-loop
Literature search

19 open access papers mention gga-mir-9-4
(328 sentences)

Stem-loop
   -      guug   uc               g      ug  g 
5'  ggguug    uua  uuugguuaucuagcu uaugag  gu u
    ||||||    |||  ||||||||||||||| ||||||  ||  
3'  cccaau    aau  aagccaauagaucga auacuu  ua c
   c      -aaa   ga               a      cu  g 
Get sequence
Deep sequencing
6253765 reads, 6.37e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr25: 1538381-1538466 [-]
intergenic
Database links

Mature sequence gga-miR-9-5p

Accession MIMAT0001195
Previous IDsgga-miR-9
Sequence

14 - 

ucuuugguuaucuagcuguauga

 - 36

Get sequence
Deep sequencing23818269 reads, 5 experiments
Evidence by similarity; MI0000466

Mature sequence gga-miR-9-4-3p

Accession MIMAT0048671
Sequence

53 - 

auaaagcuagauaaccgaaagua

 - 75

Get sequence
Deep sequencing299364 reads, 5 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).