Stem-loop sequence dre-mir-24b

AccessionMI0039518 (change log)
DescriptionDanio rerio miR-24b stem-loop
Literature search

5 open access papers mention dre-mir-24b
(78 sentences)

Stem-loop
   -    c   c   u  g   a         uaa    --   u 
5'  gguu aac ucc gu ccu cugagcuga   cagu  uga g
    |||| ||| ||| || ||| |||||||||   ||||  ||| u
3'  ccga uug agg ca gga gacuugacu   guca  auu a
   c    a   -   c  a   c         -cg    cg   u 
Get sequence
Deep sequencing
21704 reads, 1.12e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 33905762-33905845 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-24b
dre-mir-23a-3chr2: 33900435-33900512 [+]
dre-mir-27achr2: 33902325-33902455 [+]
dre-mir-24bchr2: 33905762-33905845 [+]
Database links

Mature sequence dre-miR-24b-5p

Accession MIMAT0048662
Sequence

14 - 

gugccuacugagcugauaacagu

 - 36

Get sequence
Deep sequencing892 reads, 10 experiments
Evidence not experimental

Mature sequence dre-miR-24b-3p

Accession MIMAT0048663
Sequence

52 - 

uggcucaguucagcaggaaccg

 - 73

Get sequence
Deep sequencing20812 reads, 11 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).