Stem-loop sequence dre-mir-204-3

AccessionMI0039516 (change log)
DescriptionDanio rerio miR-204-3 stem-loop
Literature search

4 open access papers mention dre-mir-204-3
(18 sentences)

Stem-loop
        cug               ca    a     agagu 
5' gugac   uggguuucccuuugu  uccu ugccu     u
   |||||   |||||||||||||||  |||| |||||     u
3' cacug   acucggagggaaacg  aggg acgga     g
        ccg               ac    -     auagu 
Get sequence
Deep sequencing
142251 reads, 8.47e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr25: 34590792-34590873 [+]
intergenic
Database links

Mature sequence dre-miR-204-5p

Accession MIMAT0001279
Previous IDsdre-miR-204
Sequence

14 - 

uucccuuugucauccuaugccu

 - 35

Get sequence
Deep sequencing340914 reads, 11 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-204-3-3p

Accession MIMAT0048659
Sequence

51 - 

gcagggacagcaaagggaggc

 - 71

Get sequence
Deep sequencing544 reads, 11 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).