Stem-loop sequence dre-mir-181a-5

AccessionMI0039513 (change log)
DescriptionDanio rerio miR-181a-5 stem-loop
Literature search

18 open access papers mention dre-mir-181a-5
(68 sentences)

Stem-loop
   gc        caga   u      cu       a     aga 
5'   uggucucg    aca ucaacg  gucggug guuuu   c
     ||||||||    ||| ||||||  ||||||| |||||   a
3'   accggagu    ugu aguugc  cagcuac caaaa   u
   gc        cccg   c      --       -     agu 
Get sequence
Deep sequencing
940954 reads, 6.01e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 45204633-45204716 [-]
intergenic
KZ115050.1: 36861-36944 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-181a-5
dre-mir-181a-5chr2: 45204633-45204716 [-]
dre-mir-181b-1chr2: 45202223-45202331 [-]
Database links

Mature sequence dre-miR-181a-5p

Accession MIMAT0001623
Previous IDsdre-miR-181a
Sequence

14 - 

aacauucaacgcugucggugagu

 - 36

Get sequence
Deep sequencing4592586 reads, 11 experiments
Evidence by similarity; MI0001380

Mature sequence dre-miR-181a-5-3p

Accession MIMAT0048655
Sequence

52 - 

accaucgaccguugacugugcc

 - 73

Get sequence
Deep sequencing22369 reads, 11 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).