Stem-loop sequence dre-mir-181a-4

AccessionMI0039511 (change log)
DescriptionDanio rerio miR-181a-4 stem-loop
Literature search

18 open access papers mention dre-mir-181a-4
(68 sentences)

Stem-loop
       ca   u   a   uu     cu       a     gau 
5' ggug  uuc ggg aca  caacg  gucggug guuug   g
   ||||  ||| ||| |||  |||||  ||||||| |||||   c
3' ccau  gag ccc ugu  guugc  cagcuac caaau   a
       ua   u   g   cg     --       -     aau 
Get sequence
Deep sequencing
930786 reads, 5.96e+04 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr21: 8221805-8221888 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-181a-4
dre-mir-181a-4chr21: 8221805-8221888 [-]
dre-mir-181dchr21: 8221660-8221743 [-]
Database links

Mature sequence dre-miR-181a-5p

Accession MIMAT0001623
Previous IDsdre-miR-181a
Sequence

14 - 

aacauucaacgcugucggugagu

 - 36

Get sequence
Deep sequencing4592586 reads, 11 experiments
Evidence by similarity; MI0001380

Mature sequence dre-miR-181a-4-3p

Accession MIMAT0048653
Sequence

52 - 

accaucgaccguuggcugugcc

 - 73

Get sequence
Deep sequencing12307 reads, 11 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).