Stem-loop sequence dre-mir-138-2

AccessionMI0039510 (change log)
DescriptionDanio rerio miR-138-2 stem-loop
Literature search

4 open access papers mention dre-mir-138-2
(9 sentences)

Stem-loop
          ca    ag             uc      --  g gg 
5' gauggag  ggac  cugguguugugaa  aggccg  cc u  u
   |||||||  ||||  |||||||||||||  ||||||  || |   
3' cuacuuc  ucug  gaccacaacacuu  uucggc  gg a  g
          ac    -g             -c      au  g aa 
Get sequence
Deep sequencing
8059 reads, 200 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr16: 7836257-7836342 [-]
intergenic
Database links

Mature sequence dre-miR-138-5p

Accession MIMAT0001835
Previous IDsdre-miR-138
Sequence

14 - 

agcugguguugugaaucaggccg

 - 36

Get sequence
Deep sequencing15786 reads, 12 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-138-2-3p

Accession MIMAT0048652
Sequence

55 - 

gcuucuucacaacaccagggu

 - 75

Get sequence
Deep sequencing163 reads, 4 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).