Stem-loop sequence dre-mir-129-3

AccessionMI0039507 (change log)
DescriptionDanio rerio miR-129-3 stem-loop
Literature search

3 open access papers mention dre-mir-129-3
(12 sentences)

Stem-loop
        u     -cu       c   cu      g   uuccuua 
5' guccu cacgg   cuuuuug ggu  gggcuu cug       a
   ||||| |||||   ||||||| |||  |||||| |||       a
3' uaggg guguc   gaaaaac cca  cccgaa gac       u
        u     uau       c   uu      g   ugaccac 
Get sequence
Deep sequencing
548 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr18: 10670657-10670746 [+]
intergenic
Database links

Mature sequence dre-miR-129-5p

Accession MIMAT0001825
Previous IDsdre-miR-129
Sequence

14 - 

cuuuuugcggucugggcuugcu

 - 35

Get sequence
Deep sequencing1532 reads, 9 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-129-3-3p

Accession MIMAT0048649
Sequence

58 - 

aagcccuuaccccaaaaaguau

 - 79

Get sequence
Deep sequencing161 reads, 5 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).