Stem-loop sequence gga-mir-449d

AccessionMI0039506 (change log)
DescriptionGallus gallus miR-449d stem-loop
Literature search

4 open access papers mention gga-mir-449d
(7 sentences)

Stem-loop
   --     -     auua         uu       a    cucuu 
5'   gugug ugaug    ggcagugua  guuaguu gcug     c
     ||||| |||||    |||||||||  ||||||| ||||      
3'   uacac auuac    ccgucacau  caaucaa cgac     a
   ac     g     ---a         --       -    cacau 
Get sequence
Deep sequencing
282 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 16702080-16702162 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-449d
gga-mir-449cchrZ: 16704099-16704170 [-]
gga-mir-449bchrZ: 16703096-16703189 [-]
gga-mir-449achrZ: 16702946-16703031 [-]
gga-mir-449dchrZ: 16702080-16702162 [-]
Database links

Mature sequence gga-miR-449d-5p

Accession MIMAT0048647
Sequence

14 - 

aggcaguguauuguuaguuagcugc

 - 38

Get sequence
Deep sequencing280 reads, 4 experiments
Evidence experimental; Illumina [2]

Mature sequence gga-miR-449d-3p

Accession MIMAT0048648
Sequence

51 - 

agcaacuaacuacacugccaca

 - 72

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).
2
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).