Stem-loop sequence mmu-mir-1911

AccessionMI0039504 (change log)
DescriptionMus musculus miR-1911 stem-loop
Literature search

2 open access papers mention mmu-mir-1911
(2 sentences)

Stem-loop
     u   ca  u  u   u  a  c       u    cau u 
5' gc ggg  uc gu gag ac gc augucug uggg   c a
   || |||  || || ||| || || ||||||| ||||   |  
3' ug cuc  ag cg cuc ug ug uacggac accu   g c
     u   uc  u  u   -  g  u       c    ucu a 
Get sequence
Deep sequencing
6 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 147106965-147107047 [+]
intergenic
Database links

Mature sequence mmu-miR-1911-5p

Accession MIMAT0048643
Sequence

14 - 

ugaguacagccaugucuguuggg

 - 36

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

Mature sequence mmu-miR-1911-3p

Accession MIMAT0048644
Sequence

51 - 

caccaggcauuguggucucugc

 - 72

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).