Stem-loop sequence mmu-mir-1271

AccessionMI0039503 (change log)
DescriptionMus musculus miR-1271 stem-loop
Literature search

7 open access papers mention mmu-mir-1271
(28 sentences)

Stem-loop
   a  -   gug    -        c     a       guaag 
5'  cc cag   agug cuuggcac uggua gcacuca     u
    || |||   |||| |||||||| ||||| |||||||      
3'  gg guc   uuac gaaccgug gucau cgugagu     a
   -  a   gug    a        u     c       aguuu 
Get sequence
Deep sequencing
9 reads, 42.9 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 54578139-54578221 [+]
intergenic
Database links

Mature sequence mmu-miR-1271-5p

Accession MIMAT0048641
Sequence

14 - 

cuuggcaccugguaagcacuca

 - 35

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

Mature sequence mmu-miR-1271-3p

Accession MIMAT0048642
Sequence

50 - 

agugccuacugugugccaagaca

 - 72

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).