Stem-loop sequence hsa-mir-6529

AccessionMI0039501 (change log)
DescriptionHomo sapiens miR-6529 stem-loop
Literature search

3 open access papers mention hsa-mir-6529
(4 sentences)

Stem-loop
   a   -  uu       -   a c          a  gcg   gu 
5'  acc ug  cucuuga gag u agaggcgcag gu   uca  g
    ||| ||  ||||||| ||| | |||||||||| ||   |||  u
3'  ugg au  gagaauu cuu a uuuccguguc cg   agu  c
   -   c  gc       u   c u          -  --a   aa 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 120084564-120084648 [-]
intergenic
Database links

Mature sequence hsa-miR-6529-5p

Accession MIMAT0048637
Sequence

14 - 

gagagaucagaggcgcagagug

 - 35

Get sequence
Deep sequencing18 reads, 11 experiments
Evidence not experimental

Mature sequence hsa-miR-6529-3p

Accession MIMAT0048638
Sequence

53 - 

ccugugccuuuuacuucuuuaa

 - 74

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).