Stem-loop sequence hsa-mir-3085

AccessionMI0039500 (change log)
DescriptionHomo sapiens miR-3085 stem-loop
Literature search

2 open access papers mention hsa-mir-3085
(5 sentences)

Stem-loop
   c  -u         a  u     ucu ag      g   uu   u 
5'  cc  acucuggga gg gccau   g  ggccag agu  gau a
    ||  ||||||||| || |||||   |  |||||| |||  ||| u
3'  gg  ugggacccu cc cggua   c  ucgguc uca  cug g
   -  uc         c  c     --u -g      -   --   u 
Get sequence
Deep sequencing
131 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 97875813-97875897 [-]
intergenic
Database links

Mature sequence hsa-miR-3085-5p

Accession MIMAT0048635
Sequence

14 - 

aggugccauucugagggccaggagu

 - 38

Get sequence
Deep sequencing45 reads, 16 experiments
Evidence not experimental

Mature sequence hsa-miR-3085-3p

Accession MIMAT0048636
Sequence

54 - 

ucuggcugcuauggcccccuc

 - 74

Get sequence
Deep sequencing67 reads, 21 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).