Stem-loop sequence hsa-mir-3059

AccessionMI0039499 (change log)
DescriptionHomo sapiens miR-3059 stem-loop
Literature search

1 open access papers mention hsa-mir-3059
(1 sentences)

Stem-loop
       g  a     uuu   -    gc   a     u    cu 
5' aggu gu caccc   ccu cucu  ccc uaggg guag  c
   |||| || |||||   ||| ||||  ||| ||||| ||||   
3' uccg ca guggg   gga gaga  ggg aucuc cauc  u
       a  a     -uu   a    -a   -     c    aa 
Get sequence
Deep sequencing
1616 reads, 8.33 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 86745068-86745149 [-]
intergenic
Database links

Mature sequence hsa-miR-3059-5p

Accession MIMAT0048633
Sequence

14 - 

uuuccucucugccccauagggugu

 - 37

Get sequence
Deep sequencing1329 reads, 43 experiments
Evidence not experimental

Mature sequence hsa-miR-3059-3p

Accession MIMAT0048634
Sequence

50 - 

ccucuagggaagagaagguugg

 - 71

Get sequence
Deep sequencing281 reads, 16 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).