Stem-loop sequence ocu-mir-12093

AccessionMI0039495 (change log)
DescriptionOryctolagus cuniculus miR-12093 stem-loop
Stem-loop
   --           u   a   gu ucaaa 
5'   agagcuaccuc ggg cug  u     c
     ||||||||||| ||| |||  |      
3'   ucuugaugggg ccc gac  a     u
   ag           u   c   ug ucuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL018731.1: 727960-728017 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-12093
ocu-mir-452GL018731.1: 726712-726772 [+]
ocu-mir-224GL018731.1: 727743-727810 [+]
ocu-mir-12093GL018731.1: 727960-728017 [+]
Database links

Mature sequence ocu-miR-12093-5p

Accession MIMAT0048625
Sequence

1 - 

agagcuaccucugggacugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-12093-3p

Accession MIMAT0048626
Sequence

37 - 

ucagccccugggguaguucuga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).