Stem-loop sequence ocu-mir-452

AccessionMI0039414 (change log)
DescriptionOryctolagus cuniculus miR-452 stem-loop
Stem-loop
   a   -g        g  a        uuug 
5'  acu  uuugcaga ga acugagac    u
    |||  |||||||| || ||||||||    a
3'  uga  aaacgucu cu ugacucug    a
   -   ag        a  c        uauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL018731.1: 726712-726772 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-452
ocu-mir-452GL018731.1: 726712-726772 [+]
ocu-mir-224GL018731.1: 727743-727810 [+]
ocu-mir-12093GL018731.1: 727960-728017 [+]
Database links

Mature sequence ocu-miR-452-5p

Accession MIMAT0048463
Sequence

1 - 

aacuguuugcagaggaaacugaga

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-452-3p

Accession MIMAT0048464
Sequence

40 - 

ucagucucaucugcaaagaagu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).