Stem-loop sequence ocu-mir-433

AccessionMI0039406 (change log)
DescriptionOryctolagus cuniculus miR-433 stem-loop
Stem-loop
   --ua   u           u  -----    ---a    cu 
5'     cgg gagccugucau au     ucag    gagg  a
       ||| ||||||||||| ||     ||||    ||||   
3'     gcu cucggguagua ua     aguc    cucc  g
   ugug   c           c  ggaag    gucg    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL019048.1: 6784-6857 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-433
ocu-mir-337GL019048.1: 1562-1622 [+]
ocu-mir-433GL019048.1: 6784-6857 [+]
ocu-mir-127GL019048.1: 7903-7958 [+]
ocu-mir-432GL019048.1: 9852-9920 [+]
ocu-mir-136GL019048.1: 10072-10127 [+]
Database links

Mature sequence ocu-miR-433-5p

Accession MIMAT0048449
Sequence

1 - 

uacggugagccugucauuauuc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-433-3p

Accession MIMAT0048450
Sequence

53 - 

aucaugaugggcuccucggugu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).