Stem-loop sequence ocu-mir-432

AccessionMI0039405 (change log)
DescriptionOryctolagus cuniculus miR-432 stem-loop
Stem-loop
   --ucu     ua       g     a   u -   u 
5'      uggag  ggucauu ggugg ucc c uaa u
        |||||  ||||||| ||||| ||| | |||  
3'      accuc  ucgguag ucacc ggg g auu c
   ucugu     -c       g     -   u c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL019048.1: 9852-9920 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-432
ocu-mir-337GL019048.1: 1562-1622 [+]
ocu-mir-433GL019048.1: 6784-6857 [+]
ocu-mir-127GL019048.1: 7903-7958 [+]
ocu-mir-432GL019048.1: 9852-9920 [+]
ocu-mir-136GL019048.1: 10072-10127 [+]
Database links

Mature sequence ocu-miR-432-5p

Accession MIMAT0048447
Sequence

1 - 

ucuuggaguaggucauugggugg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-432-3p

Accession MIMAT0048448
Sequence

48 - 

acuggauggcuccuccaugucu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).