Stem-loop sequence ocu-mir-425

AccessionMI0039404 (change log)
DescriptionOryctolagus cuniculus miR-425 stem-loop
Stem-loop
   --aau       u  c     u  a  -----  g 
5'      gacacga ca ucccg ug gu     gg c
        ||||||| || ||||| || ||     ||  
3'      cugugcu gu agggc ac cg     cc a
   cccgc       -  a     u  -  aagga  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000798.1: 16649322-16649384 [-]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-425
ocu-mir-191CM000798.1: 16649737-16649828 [-]
ocu-mir-425CM000798.1: 16649322-16649384 [-]
Database links

Mature sequence ocu-miR-425-5p

Accession MIMAT0048445
Sequence

1 - 

aaugacacgaucacucccguugag

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-425-3p

Accession MIMAT0048446
Sequence

41 - 

caucgggaaugucguguccgccc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).