Stem-loop sequence ocu-mir-383

AccessionMI0039396 (change log)
DescriptionOryctolagus cuniculus miR-383 stem-loop
Stem-loop
   --a      aa    a        uugg  g 
5'    gaucag  ggug uuguggcu    gu g
      ||||||  |||| ||||||||    || a
3'    cugguc  ucac gacaccga    cg u
   aga      cg    -        cuaa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL018709.1: 835693-835754 [+]
intergenic
Database links

Mature sequence ocu-miR-383-5p

Accession MIMAT0048429
Sequence

1 - 

agaucagaaggugauuguggcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-383-3p

Accession MIMAT0048430
Sequence

42 - 

ccacagcacugccuggucaga

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).