Stem-loop sequence ocu-mir-363

AccessionMI0039379 (change log)
DescriptionOryctolagus cuniculus miR-363 stem-loop
Stem-loop
   --         ca  a         --ga   gu 
5'   cggguggau  cg ugcaauuuu    uua  a
     |||||||||  || |||||||||    |||   
3'   gucuaccua  gc acguuaaaa    gau  c
   au         ug  -         agag   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000811.1: 108518210-108518274 [-]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-363
ocu-mir-106aCM000811.1: 108519035-108519093 [-]
ocu-mir-18bCM000811.1: 108518869-108518933 [-]
ocu-mir-20bCM000811.1: 108518633-108518692 [-]
ocu-mir-19b-2CM000811.1: 108518503-108518568 [-]
ocu-mir-92a-2CM000811.1: 108518367-108518428 [-]
ocu-mir-363CM000811.1: 108518210-108518274 [-]
Database links

Mature sequence ocu-miR-363-5p

Accession MIMAT0048397
Sequence

1 - 

cggguggaucacgaugcaauuuu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-363-3p

Accession MIMAT0048398
Sequence

44 - 

aauugcacgguauccaucugua

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).