Stem-loop sequence ocu-mir-337

AccessionMI0039372 (change log)
DescriptionOryctolagus cuniculus miR-337 stem-loop
Stem-loop
   ---   c   u     c        au  ca 
5'    gaa ggc ucaua aggaguug  ug  c
      ||| ||| ||||| ||||||||  ||   
3'    cuu ccg aguau uccucgac  ac  a
   cuu   u   u     a        cu  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL019048.1: 1562-1622 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-337
ocu-mir-337GL019048.1: 1562-1622 [+]
ocu-mir-433GL019048.1: 6784-6857 [+]
ocu-mir-127GL019048.1: 7903-7958 [+]
ocu-mir-432GL019048.1: 9852-9920 [+]
ocu-mir-136GL019048.1: 10072-10127 [+]
Database links

Mature sequence ocu-miR-337-5p

Accession MIMAT0048384
Sequence

1 - 

gaacggcuucauacaggagu

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-337-3p

Accession MIMAT0048385
Sequence

41 - 

uccuauaugaugccuuucuuc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).