Stem-loop sequence ocu-mir-224

AccessionMI0039360 (change log)
DescriptionOryctolagus cuniculus miR-224 stem-loop
Literature search

1 open access papers mention ocu-mir-224
(3 sentences)

Stem-loop
   --ca         u   u      ---  u     g 
5'     agucacuag ggu ccguuu   ag agaug u
       ||||||||| ||| ||||||   || ||||| u
3'     ucagugauc ccg gguaaa   uc uuuac u
   aaca         -   u      acu  -     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL018731.1: 727743-727810 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-224
ocu-mir-452GL018731.1: 726712-726772 [+]
ocu-mir-224GL018731.1: 727743-727810 [+]
ocu-mir-12093GL018731.1: 727960-728017 [+]
Database links

Mature sequence ocu-miR-224-5p

Accession MIMAT0048360
Sequence

1 - 

caagucacuagugguuccguuuag

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-224-3p

Accession MIMAT0048361
Sequence

46 - 

aaauggugcccuagugacuacaa

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).