Stem-loop sequence ocu-mir-223

AccessionMI0039359 (change log)
DescriptionOryctolagus cuniculus miR-223 stem-loop
Literature search

2 open access papers mention ocu-mir-223
(52 sentences)

Stem-loop
   --cgu              gaguug       cgu 
5'      guauuugacaagcu      gacacuc   g
        ||||||||||||||      |||||||   u
3'      cauaaacuguuuga      cugugag   g
   aaccc              ------       aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000811.1: 44537362-44537426 [+]
intergenic
Database links

Mature sequence ocu-miR-223-5p

Accession MIMAT0048358
Sequence

1 - 

cguguauuugacaagcugaguug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-223-3p

Accession MIMAT0048359
Sequence

43 - 

ugucaguuugucaaauaccccaa

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).