Stem-loop sequence ocu-mir-222

AccessionMI0039358 (change log)
DescriptionOryctolagus cuniculus miR-222 stem-loop
Stem-loop
   --              -     auc   ucuu 
5'   ggcucaguagccag uguag   cug    u
     |||||||||||||| |||||   |||    u
3'   cugggucaucgguc acauc   gac    g
   cu              u     gau   uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000811.1: 30973574-30973637 [-]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-222
ocu-mir-222CM000811.1: 30973574-30973637 [-]
ocu-mir-221CM000811.1: 30972910-30972972 [-]
Database links

Mature sequence ocu-miR-222-5p

Accession MIMAT0048356
Sequence

1 - 

ggcucaguagccaguguagaucc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-222-3p

Accession MIMAT0048357
Sequence

41 - 

agcuacaucuggcuacugggucuc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).