Stem-loop sequence ocu-mir-221

AccessionMI0039357 (change log)
DescriptionOryctolagus cuniculus miR-221 stem-loop
Literature search

2 open access papers mention ocu-mir-221
(3 sentences)

Stem-loop
   ---   ug   u         auuu    -   u 
5'    acc  gca acaauguag    cugu guu u
      |||  ||| |||||||||    |||| ||| u
3'    ugg  cgu uguuacauc    gaca cgg u
   cuu   gu   c         ----    a   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000811.1: 30972910-30972972 [-]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-221
ocu-mir-222CM000811.1: 30973574-30973637 [-]
ocu-mir-221CM000811.1: 30972910-30972972 [-]
Database links

Mature sequence ocu-miR-221-5p

Accession MIMAT0048354
Sequence

1 - 

accuggcauacaauguagauuucugu

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-221-3p

Accession MIMAT0048355
Sequence

41 - 

agcuacauugucugcuggguuuc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).