Stem-loop sequence ocu-mir-216a

AccessionMI0039350 (change log)
DescriptionOryctolagus cuniculus miR-216a stem-loop
Stem-loop
   --         cu   a        au   c 
5'   uaaucucag  ggc acugugag  auu a
     |||||||||  ||| ||||||||  ||| u
3'   auugggguc  cug ugacacuc  uaa a
   gu         -u   g        cc   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000791.1: 130101540-130101601 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-216a
ocu-mir-216aCM000791.1: 130101540-130101601 [+]
ocu-mir-217CM000791.1: 130108838-130108898 [+]
Database links

Mature sequence ocu-miR-216a-5p

Accession MIMAT0048341
Sequence

1 - 

uaaucucagcuggcaacugugag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-216a-3p

Accession MIMAT0048342
Sequence

41 - 

cacaguggucucugggguuaug

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).