Stem-loop sequence ocu-mir-214

AccessionMI0039348 (change log)
DescriptionOryctolagus cuniculus miR-214 stem-loop
Literature search

2 open access papers mention ocu-mir-214
(4 sentences)

Stem-loop
   --         aca            aacau 
5'   ugccugucu   cuugcugugcag     c
     |||||||||   ||||||||||||     c
3'   acggacaga   ggacgacauguc     g
   ug         cac            cacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000802.1: 20634041-20634103 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-214
ocu-mir-199a-2CM000802.1: 20628416-20628476 [+]
ocu-mir-214CM000802.1: 20634041-20634103 [+]
Database links

Mature sequence ocu-miR-214-5p

Accession MIMAT0048337
Sequence

1 - 

ugccugucuacacuugcugugc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-214-3p

Accession MIMAT0048338
Sequence

42 - 

acagcaggcacagacaggcagu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).