Stem-loop sequence ocu-mir-205

AccessionMI0039342 (change log)
DescriptionOryctolagus cuniculus miR-205 stem-loop
Stem-loop
   --uc           c        ucuca 
5'     cuucauuccac ggagucug     u
       ||||||||||| ||||||||     a
3'     gaagugaggug cuuuagac     c
   acuu           a        caacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000805.1: 63274211-63274269 [-]
intergenic
Database links

Mature sequence ocu-miR-205-5p

Accession MIMAT0048325
Sequence

1 - 

uccuucauuccaccggagucug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-205-3p

Accession MIMAT0048326
Sequence

38 - 

gauuucaguggagugaaguuca

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).