Stem-loop sequence ocu-mir-200c

AccessionMI0039340 (change log)
DescriptionOryctolagus cuniculus miR-200c stem-loop
Literature search

1 open access papers mention ocu-mir-200c
(3 sentences)

Stem-loop
   --    -      a        u   u   gg 
5'   cguc uuaccc gcaguguu ggg gcu  u
     |||| |||||| |||||||| ||| |||  u
3'   guag aauggg cgucauaa cuc uga  g
   ag    u      c        u   -   gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000797.1: 32966987-32967049 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-200c
ocu-mir-200cCM000797.1: 32966987-32967049 [+]
ocu-mir-141CM000797.1: 32967353-32967417 [+]
Database links

Mature sequence ocu-miR-200c-5p

Accession MIMAT0048321
Sequence

1 - 

cgucuuacccagcaguguuugg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-200c-3p

Accession MIMAT0048322
Sequence

41 - 

uaauacugccggguaaugaugga

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).