Stem-loop sequence ocu-mir-146b

AccessionMI0039305 (change log)
DescriptionOryctolagus cuniculus miR-146b stem-loop
Literature search

1 open access papers mention ocu-mir-146b
(7 sentences)

Stem-loop
   -ug        a    a    c   ga  u 
5'    agaacuga uucc uagg cgu  gc c
      |||||||| |||| |||| |||  ||  
3'    ucuugacu aggg gucc gua  cg u
   ugg        c    -    c   aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000807.1: 50441898-50441957 [+]
intergenic
Database links

Mature sequence ocu-miR-146b-5p

Accession MIMAT0048255
Sequence

1 - 

ugagaacugaauuccauaggccgu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-146b-3p

Accession MIMAT0048256
Sequence

39 - 

gcccuggggacucaguucuggu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).