Stem-loop sequence ocu-mir-141

AccessionMI0039299 (change log)
DescriptionOryctolagus cuniculus miR-141 stem-loop
Literature search

1 open access papers mention ocu-mir-141
(1 sentences)

Stem-loop
   --      --    c        -   ugg  ua 
5'   caucuu  ccag acaguguu gga   uc  c
     ||||||  |||| |||||||| |||   ||  u
3'   guagaa  gguc ugucacaa ccu   ag  u
   cg      au    -        u   cga  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000797.1: 32967353-32967417 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-141
ocu-mir-200cCM000797.1: 32966987-32967049 [+]
ocu-mir-141CM000797.1: 32967353-32967417 [+]
Database links

Mature sequence ocu-miR-141-5p

Accession MIMAT0048243
Sequence

1 - 

caucuuccagcacaguguugga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-141-3p

Accession MIMAT0048244
Sequence

43 - 

uaacacugucugguaaagauggc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).