Stem-loop sequence ocu-mir-136

AccessionMI0039293 (change log)
DescriptionOryctolagus cuniculus miR-136 stem-loop
Stem-loop
   --    c     uuu          u c 
5'   acuc auuug   ugaugaugga u u
     |||| |||||   |||||||||| | u
3'   ugag uaaac   gcuacuaccu g a
   uc    -     ucu          c g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL019048.1: 10072-10127 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-136
ocu-mir-337GL019048.1: 1562-1622 [+]
ocu-mir-433GL019048.1: 6784-6857 [+]
ocu-mir-127GL019048.1: 7903-7958 [+]
ocu-mir-432GL019048.1: 9852-9920 [+]
ocu-mir-136GL019048.1: 10072-10127 [+]
Database links

Mature sequence ocu-miR-136-5p

Accession MIMAT0048232
Sequence

1 - 

acuccauuuguuuugaugaugga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-136-3p

Accession MIMAT0048233
Sequence

35 - 

caucaucgucucaaaugagucu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).