Stem-loop sequence ocu-mir-127

AccessionMI0039280 (change log)
DescriptionOryctolagus cuniculus miR-127 stem-loop
Literature search

1 open access papers mention ocu-mir-127
(3 sentences)

Stem-loop
   -cug         g  c      --  a 
5'     aagcucaga gg ucugau  uc g
       ||||||||| || ||||||  || a
3'     uucgagucu cc aggcua  ag a
   ucgg         g  u      cu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL019048.1: 7903-7958 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-127
ocu-mir-337GL019048.1: 1562-1622 [+]
ocu-mir-433GL019048.1: 6784-6857 [+]
ocu-mir-127GL019048.1: 7903-7958 [+]
ocu-mir-432GL019048.1: 9852-9920 [+]
ocu-mir-136GL019048.1: 10072-10127 [+]
Database links

Mature sequence ocu-miR-127-5p

Accession MIMAT0048208
Sequence

1 - 

cugaagcucagagggcucugauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-127-3p

Accession MIMAT0048209
Sequence

35 - 

ucggauccgucugagcuuggcu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).