Stem-loop sequence ocu-mir-125b-1

AccessionMI0039278 (change log)
DescriptionOryctolagus cuniculus miR-125b-1 stem-loop
Literature search

1 open access papers mention ocu-mir-125b-1
(2 sentences)

Stem-loop
   --uc  ug   c           au     c 
5'     cc  aga ccuaacuugug  guuua c
       ||  ||| |||||||||||  ||||| g
3'     gg  ucu ggauugggcac  uaaau u
   ucga  gu   c           -c     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000790.1: 95926707-95926768 [+]
intergenic
Database links

Mature sequence ocu-miR-125b-5p

Accession MIMAT0048205
Sequence

1 - 

ucccugagacccuaacuuguga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-125b-3p

Accession MIMAT0048206
Sequence

41 - 

acggguuaggcucuugggagcu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).