Stem-loop sequence ocu-mir-106b

AccessionMI0039273 (change log)
DescriptionOryctolagus cuniculus miR-106b stem-loop
Stem-loop
   --ua       g       a a    --  uc 
5'     aagugcu acagugc g uagu  gg  c
       ||||||| ||||||| | ||||  ||   
3'     uucaugg ugucacg c aucg  cc  u
   gucg       g       c -    ug  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL018760.1: 102749-102809 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-106b
ocu-mir-106bGL018760.1: 102749-102809 [+]
ocu-mir-93GL018760.1: 102971-103032 [+]
ocu-mir-25GL018760.1: 103178-103237 [+]
Database links

Mature sequence ocu-miR-106b-5p

Accession MIMAT0048197
Sequence

1 - 

uaaagugcugacagugcagaua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-106b-3p

Accession MIMAT0048198
Sequence

41 - 

ccgcacuguggguacuugcug

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).