Stem-loop sequence ocu-mir-99a

AccessionMI0039264 (change log)
DescriptionOryctolagus cuniculus miR-99a stem-loop
Stem-loop
   --a         uc   u      g  aag 
5'    acccguaga  cga cuugug ug   u
      |||||||||  ||| |||||| ||    
3'    uggguaucu  gcu gaacac gc   g
   guc         uc   c      -  cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000803.1: 144547521-144547579 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-99a
ocu-mir-99aCM000803.1: 144547521-144547579 [+]
ocu-let-7cCM000803.1: 144548251-144548317 [+]
Database links

Mature sequence ocu-miR-99a-5p

Accession MIMAT0048182
Sequence

1 - 

aacccguagauccgaucuugug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-99a-3p

Accession MIMAT0048183
Sequence

38 - 

caagcucgcuucuaugggucug

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).