Stem-loop sequence ocu-mir-93

AccessionMI0039261 (change log)
DescriptionOryctolagus cuniculus miR-93 stem-loop
Stem-loop
   ---ca       -     u    g   u  g u 
5'      aagugcu guucg gcag uag gu a u
        ||||||| ||||| |||| ||| || | a
3'      uucacga cgagu cguc auc ca u c
   agccc       u     -    -   -  g c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL018760.1: 102971-103032 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-93
ocu-mir-106bGL018760.1: 102749-102809 [+]
ocu-mir-93GL018760.1: 102971-103032 [+]
ocu-mir-25GL018760.1: 103178-103237 [+]
Database links

Mature sequence ocu-miR-93-5p

Accession MIMAT0048176
Sequence

1 - 

caaagugcuguucgugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-93-3p

Accession MIMAT0048177
Sequence

40 - 

acugcugagcuagcacuucccga

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).