Stem-loop sequence ocu-mir-27b

AccessionMI0039241 (change log)
DescriptionOryctolagus cuniculus miR-27b stem-loop
Stem-loop
   --            auug        ugauu   u 
5'   agagcuuagcug    gugaacag     ggu u
     ||||||||||||    ||||||||     |||  
3'   ucuugaaucggu    cacuuguu     ccg c
   cg            --ga        -----   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000790.1: 74102379-74102441 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-27b
ocu-mir-23bCM000790.1: 74102158-74102217 [+]
ocu-mir-27bCM000790.1: 74102379-74102441 [+]
ocu-mir-24-1CM000790.1: 74102787-74102846 [+]
Database links

Mature sequence ocu-miR-27b-5p

Accession MIMAT0048139
Sequence

1 - 

agagcuuagcugauuggugaaca

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-27b-3p

Accession MIMAT0048140
Sequence

43 - 

uucacaguggcuaaguucugc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).