Stem-loop sequence ocu-mir-26b

AccessionMI0039240 (change log)
DescriptionOryctolagus cuniculus miR-26b stem-loop
Literature search

1 open access papers mention ocu-mir-26b
(2 sentences)

Stem-loop
   --u         uc           u ug 
5'    ucaaguaau  aggauagguug g  c
      |||||||||  ||||||||||| |   
3'    gguucauua  ucuuguccgac c  u
   cuc         cc           - ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000796.1: 159720534-159720590 [+]
intergenic
Database links

Mature sequence ocu-miR-26b-5p

Accession MIMAT0048137
Sequence

1 - 

uucaaguaauucaggauagguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-26b-3p

Accession MIMAT0048138
Sequence

36 - 

ccuguucuccauuacuuggcuc

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).