Stem-loop sequence ocu-mir-26a

AccessionMI0039239 (change log)
DescriptionOryctolagus cuniculus miR-26a stem-loop
Literature search

1 open access papers mention ocu-mir-26a
(1 sentences)

Stem-loop
   --uu         c          g ug c 
5'     caaguaauc aggauaggcu u  c a
       ||||||||| |||||||||| |  | u
3'     guucauuag ucuuauccgg a  g c
   cuuu         u          - gu c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL018714.1: 918076-918135 [-]
intergenic
Database links

Mature sequence ocu-miR-26a-5p

Accession MIMAT0048135
Sequence

1 - 

uucaaguaauccaggauaggcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-26a-3p

Accession MIMAT0048136
Sequence

39 - 

ccuauucuugauuacuuguuuc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).