Stem-loop sequence ocu-mir-23b

AccessionMI0039235 (change log)
DescriptionOryctolagus cuniculus miR-23b stem-loop
Literature search

1 open access papers mention ocu-mir-23b
(2 sentences)

Stem-loop
   --  --          -  c      gugacu 
5'   gg  guuccuggca ug ugauuu      u
     ||  |||||||||| || ||||||       
3'   cc  uagggaccgu ac acuaaa      a
   ca  au          u  -      auuaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000790.1: 74102158-74102217 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-23b
ocu-mir-23bCM000790.1: 74102158-74102217 [+]
ocu-mir-27bCM000790.1: 74102379-74102441 [+]
ocu-mir-24-1CM000790.1: 74102787-74102846 [+]
Database links

Mature sequence ocu-miR-23b-5p

Accession MIMAT0048128
Sequence

1 - 

ggguuccuggcaugcugauuu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-23b-3p

Accession MIMAT0048129
Sequence

38 - 

aucacauugccagggauuaccac

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).