Stem-loop sequence ocu-mir-21

AccessionMI0039233 (change log)
DescriptionOryctolagus cuniculus miR-21 stem-loop
Literature search

5 open access papers mention ocu-mir-21
(126 sentences)

Stem-loop
   --         a     a     a    u a 
5'   uagcuuauc gacug uguug cugu g a
     ||||||||| ||||| ||||| |||| | u
3'   gucggguag cugac acaac ggua c c
   cu         -     g     -    - u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000808.1: 28514190-28514249 [-]
intergenic
Database links

Mature sequence ocu-miR-21-5p

Accession MIMAT0048124
Sequence

1 - 

uagcuuaucagacugauguugacu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-21-3p

Accession MIMAT0048125
Sequence

39 - 

caacagcagucgaugggcuguc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).