Stem-loop sequence ocu-mir-20b

AccessionMI0039232 (change log)
DescriptionOryctolagus cuniculus miR-20b stem-loop
Stem-loop
   --ca           g     g   uucua 
5'     aagugcucaua ugcag uag     g
       ||||||||||| ||||| |||     c
3'     uucacgagugu auguc auc     a
   gauc           g     -   uuacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000811.1: 108518633-108518692 [-]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-20b
ocu-mir-106aCM000811.1: 108519035-108519093 [-]
ocu-mir-18bCM000811.1: 108518869-108518933 [-]
ocu-mir-20bCM000811.1: 108518633-108518692 [-]
ocu-mir-19b-2CM000811.1: 108518503-108518568 [-]
ocu-mir-92a-2CM000811.1: 108518367-108518428 [-]
ocu-mir-363CM000811.1: 108518210-108518274 [-]
Database links

Mature sequence ocu-miR-20b-5p

Accession MIMAT0048122
Sequence

1 - 

caaagugcucauagugcagguagu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-20b-3p

Accession MIMAT0048123
Sequence

38 - 

uacuguagugugagcacuucuag

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).