Stem-loop sequence ocu-mir-19b-2

AccessionMI0039230 (change log)
DescriptionOryctolagus cuniculus miR-19b-2 stem-loop
Literature search

1 open access papers mention ocu-mir-19b-2
(1 sentences)

Stem-loop
   --         -  -       -u   gc     c 
5'   aguuuugca gg uuugcau  uca  guaua c
     ||||||||| || |||||||  |||  |||||  
3'   ucaaaacgu cc aaacgug  ggu  cauau u
   ag         a  u       uc   -a     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000811.1: 108518503-108518568 [-]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-19b-2
ocu-mir-106aCM000811.1: 108519035-108519093 [-]
ocu-mir-18bCM000811.1: 108518869-108518933 [-]
ocu-mir-20bCM000811.1: 108518633-108518692 [-]
ocu-mir-19b-2CM000811.1: 108518503-108518568 [-]
ocu-mir-92a-2CM000811.1: 108518367-108518428 [-]
ocu-mir-363CM000811.1: 108518210-108518274 [-]
Database links

Mature sequence ocu-miR-19b-2-5p

Accession MIMAT0048119
Sequence

1 - 

aguuuugcagguuugcauuuc

 - 21

Get sequence
Evidence not experimental

Mature sequence ocu-miR-19b-3p

Accession MIMAT0048118
Sequence

44 - 

ugugcaaauccaugcaaaacuga

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).