Stem-loop sequence ocu-mir-19a

AccessionMI0039228 (change log)
DescriptionOryctolagus cuniculus miR-19a stem-loop
Stem-loop
   --            --      ---    ag 
5'   aguuuugcauag  uugcac   uaca  a
     ||||||||||||  ||||||   ||||  a
3'   ucaaaacguauc  aacgug   augu  g
   ag            ua      uug    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000797.1: 93067987-93068044 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-19a
ocu-mir-17CM000797.1: 93067701-93067759 [+]
ocu-mir-18aCM000797.1: 93067839-93067903 [+]
ocu-mir-19aCM000797.1: 93067987-93068044 [+]
ocu-mir-20aCM000797.1: 93068174-93068232 [+]
ocu-mir-19b-1CM000797.1: 93068307-93068367 [+]
ocu-mir-92a-1CM000797.1: 93068424-93068482 [+]
Database links

Mature sequence ocu-miR-19a-5p

Accession MIMAT0048115
Sequence

1 - 

aguuuugcauaguugcacuac

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-19a-3p

Accession MIMAT0048116
Sequence

36 - 

ugugcaaaucuaugcaaaacuga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).